Journal: Slas Discovery

Article Title: Identification of potent small molecule inhibitors of SARS-CoV-2 entry

doi: 10.1016/j.slasd.2021.10.012

Figure Lengend Snippet: High-throughput of ReFRAME, Pathogen Box, TargetMol and Cathepsin L drug libraries for SARS-CoV-2 antiviral compounds. A. Schematic of the spike protein of SARS-CoV-2. RBD: receptor binding domain. B. Schematic of the High-throughput assay. Compounds were pre-spotted in 1536-well plates. Next, 2000 HEK293T-ACE2 cells were added to each well and pre-incubated with each compound for 1 h, followed by infection with MLV reporter luciferase virus pseudotyped with the SARS-CoV-2 Spike protein (SARS2-S) or VSV-G protein (VSV-G). Luciferase was measured 48 h later. C. Summary of the ReFRAME library results. Conc.: concentration. D. Distribution of Z-Score for primary screens of each library. Scatter plot of Z_Score for all samples tested from the ReFrame library ( N = 1; circle) and other libraries ( N = 3; Cathepsin L: square; Pathogen Box: cross; TargetMol: filled circle). Total of 16,320 samples. Positive controls: orange; Negative control: cyan; Hit compounds: red; non-hit compounds: black. E. Summary of the 3 other libraries results. F. ReFrame library screening against different targets: SARS2-S, 3CLpro and PLpro. Venn diagram analysis of comparison between hits from SARS2-S entry, 3CLpro and PLpro assay against ReFRAME library results. There are 419 compounds that are SARS2-entry specific potential inhibitors. G. Robustness in terms of Z’ score of each screen for each library.

Article Snippet: Vero E6 cells were stained with Goat anti-Human Phycoerythrin-conjugated ACE2 Polyclonal Antibody (R&D Systems) for 30 min at 4 °C in dark.

Techniques: High Throughput Screening Assay, Binding Assay, Incubation, Infection, Luciferase, Virus, Concentration Assay, Negative Control, Library Screening, Comparison

Journal: Slas Discovery

Article Title: Identification of potent small molecule inhibitors of SARS-CoV-2 entry

doi: 10.1016/j.slasd.2021.10.012

Figure Lengend Snippet: Summary of the selected Cathepsin L, Pathogen box and TargetMol compounds in this study. Activity of the selected compounds against the different MLV pseudotyped viruses in HEK293-ACE2 cells and their respective cytotoxicity. Values for SARS2-S, VSV-G and toxicity are mean ± SEM of 2–4 independent experiments. TI: therapeutic index. * n = 1.

Article Snippet: Vero E6 cells were stained with Goat anti-Human Phycoerythrin-conjugated ACE2 Polyclonal Antibody (R&D Systems) for 30 min at 4 °C in dark.

Techniques: Activity Assay

Journal: Slas Discovery

Article Title: Identification of potent small molecule inhibitors of SARS-CoV-2 entry

doi: 10.1016/j.slasd.2021.10.012

Figure Lengend Snippet: Targets of the selected compounds and SARS-CoV-2 wild type infection. A. Description of the targets of the different hits from all the studied libraries. B. Antiviral activity of the 2 best hits in the SARS-CoV-2-induced CPE assay. Vero E6 cells treated with test compounds for two hours were infected with SARS-CoV-2 at an MOI of 0.05, then incubated for three days in the presence of compound. Cell viability (protection from virus-induced CPE) was measured with CellTiter-Glo. C and D. Antiviral effect was measured with a subset of Vero E6 cells expressing a low (C) and high (D) level of ACE2. E. Cytotoxicity of selected compounds in Vero E6 cells. Cytotoxicity was tested in the same conditions with cell culture media instead of the virus. F. Virus yield reduction activity of selected compounds. Vero E6 cells infected with SARS-CoV-2 at an MOI of 0.05 were cultured in the presence of test compound (5 µM) and the supernatant was harvested after 24 and 48 h of incubation. The Progeny virus was enumerated with a plaque assay using an Avicel overlay in fresh Vero E6 cells. N = 3 experiments were performed for infectivity assays and n = 2 for the cytotoxicity assays. **** P < 0.0001, Two-way ANOVA with Dunnett's multiple comparisons test against DMSO control.

Article Snippet: Vero E6 cells were stained with Goat anti-Human Phycoerythrin-conjugated ACE2 Polyclonal Antibody (R&D Systems) for 30 min at 4 °C in dark.

Techniques: Infection, Activity Assay, Incubation, Virus, Expressing, Cell Culture, Plaque Assay, Control

Journal: Slas Discovery

Article Title: Identification of potent small molecule inhibitors of SARS-CoV-2 entry

doi: 10.1016/j.slasd.2021.10.012

Figure Lengend Snippet: SR-914 “calpeptin” specifically blocks SARS-CoV entry. A. Its activity against SARS2-S in HEK293T-ACE2-TMPRSS2 cells. Cells were incubated with different concentrations of drugs, then infected with SARS2-S or VSV-G. Luciferase was measured 48 h later, using Bright-Glo. Shown is the mean ± SEM of n = 2 to 4 independent experiments. B. Time of drug addition experiment schematic. Infection was performed for 1 h with or without drugs, Vero CCL81 cells were then washed, and fresh media was added with or without drugs. C. Time of drug addition experiment result. SR-914 was used at 10 µM. E64d at 20 µM. Calp.: calpeptin = SR-914. NI: not infected. Shown is the mean ± SEM of 4 to 6 independent experiments. D. Luciferase complementation assay schematic. The reporter consists of a split Firefly luciferase protein connected by a cleavable peptide for the tested protease. Upon cleavage of the peptide, the luciferase protein undergoes dimerization for an active state. DnaE intein helps in this dimerization. E. Its activity against SARS2-S Entry, 3CLpro and PLpro. C-: negative control. C+; positive control. Shown is the mean ± SD of 3 independent experiments. One-way ANOVA followed by Tukey's post-test were used for statistical comparisons. *, P < 0.01; **, P < 0.001; ***, P < 0.0001.

Article Snippet: Vero E6 cells were stained with Goat anti-Human Phycoerythrin-conjugated ACE2 Polyclonal Antibody (R&D Systems) for 30 min at 4 °C in dark.

Techniques: Activity Assay, Incubation, Infection, Luciferase, Negative Control, Positive Control

Journal: Slas Discovery

Article Title: Identification of potent small molecule inhibitors of SARS-CoV-2 entry

doi: 10.1016/j.slasd.2021.10.012

Figure Lengend Snippet: Breath of activity of calpeptin against various SARS-CoVs. A. Its activity against SARS1-S in HEK293T-ACE2 cells. HEK293T-ACE2 cells were incubated with different concentrations of calpeptin, then infected with SARS1-S. Luciferase was measured 48 h later, using Bright-Glo. Shown is the mean ± SEM of n = 2 independent experiments. B. Schematic of the substituted residues in the S protein of the highest threat of SARS-CoV-2 strains. C. Evolution of the S protein residues at the position 417, 484, 501 and 614 from 2019 to February 2021. Modified figure from https://nextstrain. org/ncov/global?branchLabel=none& c =gt-S_417,484,501,614& l =clock. D. Activity of the new emergent variants. HEK293T-ACE2 cells were infected with different mutants of SARS2-S. The day after, a medium change was performed. Luciferase was measured 48 h later, using Bright-Glo. Shown is the mean ± SEM of n = 3 independent experiments. WT: wild type, SA: South Africa, UK: United Kingdom. E. Activity of calpeptin activity against crucial mutations present in the S protein of the new emergent strains. Similar experiment than D but calpeptin was added during infection and after medium change. Shown is the mean ± SEM of n = 2–5 independent experiments. Two-way ANOVA followed by Dunnett's post-test were used for statistical comparisons. *, P < 0.01; **, P < 0.001; ***, P < 0.0001.

Article Snippet: Vero E6 cells were stained with Goat anti-Human Phycoerythrin-conjugated ACE2 Polyclonal Antibody (R&D Systems) for 30 min at 4 °C in dark.

Techniques: Activity Assay, Incubation, Infection, Luciferase, Modification

Journal: Viruses

Article Title: Potential Role of APOBEC3 Family Proteins in SARS-CoV-2 Replication

doi: 10.3390/v16071141

Figure Lengend Snippet: Validation of expression levels for ACE2 protein and A3 mRNAs in THP-1 parent and A3A -to- A3G -null THP-1 cells. ( A ) ACE2 protein expression levels on the surface of THP-1 parent and THP-1#11-4 ( A3A -to- A3G -null THP-1) cells. The ACE2 gene was introduced by a retroviral vector, and the expression levels of the surface ACE2 protein were detected by an anti-ACE2 polyclonal antibody (red). The number in each graph shows the percentage of ACE2 + cells compared to those stained by isotype control (gray). ( B ) A3 mRNA expression levels in Calu-3 (gray), THP-1-ACE2 (blue), and THP-1-ACE2#11-4 (red) cells. A3 mRNA expression levels were quantified by RT-qPCR and normalized to TBP mRNA levels. Each bar represents the average of three independent experiments with Standard deviation (SD). Statistical significance was determined using the two-sided unpaired t -test. *, p < 0.05 compared to THP-1 parent cells.

Article Snippet: A goat anti-ACE2 polyclonal antibody (R&D Systems, Minneapolis, MN, USA, Cat# AF933, 1:50) and an APC-conjugated donkey anti-goat IgG (R&D Systems, Cat# F0108, 1:50) were used for surface ACE2 staining ( A).

Techniques: Biomarker Discovery, Expressing, Retroviral, Plasmid Preparation, Staining, Control, Quantitative RT-PCR, Standard Deviation

Journal: Viruses

Article Title: Potential Role of APOBEC3 Family Proteins in SARS-CoV-2 Replication

doi: 10.3390/v16071141

Figure Lengend Snippet: SARS-CoV-2 replication in THP-1 parent and A3A -to- A3G -null THP-1 cells. ( A ) Replication kinetics of the Wuhan, BA.1, and BA.5 variants produced from THP-1 parent and THP-1#11-4 ( A3A -to- A3G -null THP-1) cells without (blue line) or with (red line) ACE2 protein expression. The SARS-CoV-2 N gene was quantified by RT-qPCR to monitor the viral RNA copy number across the indicated time points. Each timepoint represents the average of four independent experiments with SD. ( B ) Passage experiments. The SARS-CoV-2 N gene in the cell culture supernatants produced from THP-1-ACE2 or THP-1-ACE2#11-4 ( A3A -to- A3G -null THP-1) cells at 96 h postinfection of each passage were quantified by RT-qPCR to monitor the viral RNA copy number of the Wuhan (gray), BA.1 (blue), and BA.5 (red) variants. Each bar represents the average of three independent experiments with SD.

Article Snippet: A goat anti-ACE2 polyclonal antibody (R&D Systems, Minneapolis, MN, USA, Cat# AF933, 1:50) and an APC-conjugated donkey anti-goat IgG (R&D Systems, Cat# F0108, 1:50) were used for surface ACE2 staining ( A).

Techniques: Produced, Expressing, Quantitative RT-PCR, Cell Culture

Journal: Viruses

Article Title: Potential Role of APOBEC3 Family Proteins in SARS-CoV-2 Replication

doi: 10.3390/v16071141

Figure Lengend Snippet: SARS-CoV-2 infectivity produced from THP-1 parent and A3A -to- A3G -null THP-1 cells during passage experiments. ( A ) Representative pictures of plaque assay. Cell culture supernatants obtained from the passage experiments for the Wuhan variant were also used for plaque assay with serial 10-times dilution. ( B ) PFU/mL of the Wuhan variant produced from THP-1-ACE2 (gray) or THP-1-ACE2#11-4 ( A3A -to- A3G -null THP-1) (blue) cells at 96 h postinfection during passage experiments.

Article Snippet: A goat anti-ACE2 polyclonal antibody (R&D Systems, Minneapolis, MN, USA, Cat# AF933, 1:50) and an APC-conjugated donkey anti-goat IgG (R&D Systems, Cat# F0108, 1:50) were used for surface ACE2 staining ( A).

Techniques: Infection, Produced, Plaque Assay, Cell Culture, Variant Assay

Journal: Viruses

Article Title: Potential Role of APOBEC3 Family Proteins in SARS-CoV-2 Replication

doi: 10.3390/v16071141

Figure Lengend Snippet: Analysis of mutations in SARS-CoV-2 genomes produced from THP-1 parent and A3A -to- A3G -null THP-1 cells during passage experiments. SARS-CoV-2 genomic RNA was isolated and subjected to WGS. Sample 1 to 4: Wuhan variant from passage 1 of THP-1-ACE2 cells. Sample 5 to 8: Wuhan variant from passage 5 of THP-1-ACE2 cells. Sample 9 to 12: Wuhan variant from passage 1 of THP-1-ACE2#11-4 ( A3A -to- A3G -null THP-1) cells. Sample 13 and 14: Wuhan variant from passage 3 of THP-1-ACE2#11-4 cells. Green boxes on the top show each SARS-CoV-2 ORF gene with nucleotide position.

Article Snippet: A goat anti-ACE2 polyclonal antibody (R&D Systems, Minneapolis, MN, USA, Cat# AF933, 1:50) and an APC-conjugated donkey anti-goat IgG (R&D Systems, Cat# F0108, 1:50) were used for surface ACE2 staining ( A).

Techniques: Produced, Isolation, Variant Assay

Journal: bioRxiv

Article Title: High resolution photocatalytic mapping of SARS-CoV-2 Spike protein-host cell membrane interactions

doi: 10.1101/2022.09.02.506438

Figure Lengend Snippet: A.ViraMap study design: Selective labeling of host factors after exposing IrPC-conjugated SARS-CoV-2 Spike protein trimers, and related variants (SARS-Cov-1 Spike and SARS-CoV-2 D614G Spike) to cells expressing hACE2 under visible (450 nm) light in the presence of a biotin-diazirine probe. B. Schematics of IrPC induced labeling workflow and data analysis by flow cytometry and confocal imaging. C. Flow cytometry analysis showing cell surface biotinylation caused by the Spike-IrPC conjugate on HEK293+ACE2 cells. D. Confocal images probing the biotinylated HEK293+ACE2 cell surface upon treatment with IrPC conjugated SARS-CoV-2 D614G Spike, E. SARS-CoV-1 Spike, F. SARS-CoV-2 Spike and G. negative control isotype IgG.

Article Snippet: For the anti-ACE2 blocking assay, cells were treated for 2 hours prior to infection with the IC50 concentration of anti-ACE2 antibody (R&D Systems: AF933) determined for the cell lines used.

Techniques: Labeling, Expressing, Flow Cytometry, Imaging, Negative Control

Journal: bioRxiv

Article Title: High resolution photocatalytic mapping of SARS-CoV-2 Spike protein-host cell membrane interactions

doi: 10.1101/2022.09.02.506438

Figure Lengend Snippet: A. IrPC-labeled SARS CoV-2 Spike directed proteomics workflow. B. Enriched host factors (highlighted in red, log 2 FC≥1.5, -Log 10 Pvalue>=2.0) from targeted labeling of SARS Cov-2 wildtype Spike, SARS-CoV-2 D614G Spike, SARS-CoV-1 Spike and anti-ACE2 represented as volcano plots. The network represents an overlap of an enriched subset of proteins across proteomics experiments of 3 variants of Spike and ACE2 directed targeted labeling after scoring protein-protein interactions (MiST score cut off ≥ 0.8, SAInt FDR cut off ≤ 0.3). The nodes represent the proteins and edges represent the average of MiST score and BFDR for each interaction in the network. The nodes were clustered in 2 groups (red and blue nodes) based on the interaction overlap in the Spike-ACE2 environment. Identified host proximal proteins are denoted as yellow (known Spike proximal interactors) and blue (putative Spike proximal interactors) sub-nodes.

Article Snippet: For the anti-ACE2 blocking assay, cells were treated for 2 hours prior to infection with the IC50 concentration of anti-ACE2 antibody (R&D Systems: AF933) determined for the cell lines used.

Techniques: Labeling, Protein-Protein interactions

Journal: bioRxiv

Article Title: High resolution photocatalytic mapping of SARS-CoV-2 Spike protein-host cell membrane interactions

doi: 10.1101/2022.09.02.506438

Figure Lengend Snippet: A. Screening and target validation workflow in pseudotype model. B. Effect of SARS CoV-2 Spike-typed pseudovirus infection on 293T+ACE2 knockdown cells for 10 HC host targets read by luciferase assay (experimental n = ≥ 3; one-way ANOVA with Dunnett’s test; mean ± s.d.) C. Effect of SARS CoV-2 Spike typed pseudovirus infection on loss and gain of function of EFNB1 and PTGFRN in Caco-2 cells analyzed by luciferase assay (experimental n= 3; one-way ANOVA with Dunnett’s test; mean ± s.d.) after confirming the gene knockdown and overexpression by western blot. All measurements are normalized to the controls for each assay.

Article Snippet: For the anti-ACE2 blocking assay, cells were treated for 2 hours prior to infection with the IC50 concentration of anti-ACE2 antibody (R&D Systems: AF933) determined for the cell lines used.

Techniques: Biomarker Discovery, Infection, Knockdown, Luciferase, Over Expression, Western Blot

Journal: bioRxiv

Article Title: High resolution photocatalytic mapping of SARS-CoV-2 Spike protein-host cell membrane interactions

doi: 10.1101/2022.09.02.506438

Figure Lengend Snippet: A. Target validation workflow in authentic live virus infection model. B. PTGFRN and EFNB1 expression knockdown in HK-2 cells C. Percentage of infected cell population after normalization upon knockdown of PTGFRN and EFNB1 in HK-2 cells at different multiplicity of infection (0.5 and 3.0) and time points (12 h.p.i. and 24 h.p.i.) of infection via flow cytometry. D. Bar plots showing percentage of SARS CoV-2 infection in wildtype (WT), PTGFRN and EFNB1 knockdown HK-2 cells at different multiplicity of infection (0.5 and 3.0) and time points of infection (12 h.p.i. and 24 h.p.i.) in presence and absence of ACE2-blockade analyzed from immunofluorescence (IF) imaging (technical replicate n = 10; two-way ANOVA with Šídák’s test; mean ± s.d.). All measurements are normalized to the controls for each assay.

Article Snippet: For the anti-ACE2 blocking assay, cells were treated for 2 hours prior to infection with the IC50 concentration of anti-ACE2 antibody (R&D Systems: AF933) determined for the cell lines used.

Techniques: Biomarker Discovery, Virus, Infection, Expressing, Knockdown, Flow Cytometry, Immunofluorescence, Imaging

Journal: Arthritis Research & Therapy

Article Title: Autoantibodies to angiotensin-converting enzyme 2 in patients with connective tissue diseases

doi: 10.1186/ar3012

Figure Lengend Snippet: Summarized results of ELISA for detecting serum anti-angiotensin-converting enzyme 2 antibodies . The ELISA scores of the vasculopathy patients (n = 18) are significantly higher than those of patients without vasculopathy (n = 24) and those of healthy subjects (n = 28). Bars indicate the median. P < 0.01.

Article Snippet: To detect ACE2 proteins, an anti-human ACE2 mouse monoclonal antibody was used (R&D Systems).

Techniques: Enzyme-linked Immunosorbent Assay

Journal: Arthritis Research & Therapy

Article Title: Autoantibodies to angiotensin-converting enzyme 2 in patients with connective tissue diseases

doi: 10.1186/ar3012

Figure Lengend Snippet: Inhibition of angiotensin-converting enzyme 2 activity by IgG purified from patient serum . (a) Purified IgG from the sera of healthy volunteers (H1 to H3) and patients with vasculopathy (P1, P5, and P6) was detected by SDS-PAGE and Coomassie Brilliant Blue staining. The molecular weights of the heavy (50 kDa) and light (25 kDa) chains of IgG are shown. (b) The inhibition of angiotensin-converting enzyme (ACE) 2 activity by 5 μg purified IgG was examined in triplicate assays. As a control, ACE2 activity in standard rACE2 was measured in the absence of IgG. As shown, ACE2 activity was significantly reduced when the recombinant enzyme was co-incubated with IgG from the patients. P < 0.01. RFU, relative fluorescence unit.

Article Snippet: To detect ACE2 proteins, an anti-human ACE2 mouse monoclonal antibody was used (R&D Systems).

Techniques: Inhibition, Activity Assay, Purification, SDS Page, Staining, Control, Recombinant, Incubation, Fluorescence

Journal: Arthritis Research & Therapy

Article Title: Autoantibodies to angiotensin-converting enzyme 2 in patients with connective tissue diseases

doi: 10.1186/ar3012

Figure Lengend Snippet: Inverse correlation between the presence of angiotensin-converting enzyme 2 autoantibodies and activity in vasculopathy patients . The relative (%) activity of serum angiotensin-converting enzyme (ACE) 2 compared with the reference value and ELISA score of the same sera were plotted in (a) 26 healthy subjects, (b) 16 patients without vasculopathy, and (c) 18 vasculopathy patients, respectively, and Pearson correlation coefficients were calculated. The relative ACE2 activities were determined based on a reference serum (mixed sera from healthy subjects). (d) Western blot analysis to detect ACE2 protein in serum. Immunoprecipitation followed by immunoblotting was performed on sera of healthy subjects (H1 to H3) and vasculopathy patients (P1 to P5). ACE2 was detected as a major band about 90 kDa in size (see also Additional file ).

Article Snippet: To detect ACE2 proteins, an anti-human ACE2 mouse monoclonal antibody was used (R&D Systems).

Techniques: Activity Assay, Enzyme-linked Immunosorbent Assay, Western Blot, Immunoprecipitation

Journal: Arthritis Research & Therapy

Article Title: Autoantibodies to angiotensin-converting enzyme 2 in patients with connective tissue diseases

doi: 10.1186/ar3012

Figure Lengend Snippet: Anti-angiotensin-converting enzyme 2 antibodies and activity in a systemic lupus erythematosus patient . Anti-angiotensin-converting enzyme (ACE) 2 antibodies and ACE activity in a systemic lupus erythematosus patient (SLE) before and after therapy. (a) The ELISA score and (b) the ACE2 activity of Patient 1 (P1) recovered significantly after therapy.

Article Snippet: To detect ACE2 proteins, an anti-human ACE2 mouse monoclonal antibody was used (R&D Systems).

Techniques: Activity Assay, Enzyme-linked Immunosorbent Assay

Journal: Virology

Article Title: Identification of critical determinants on ACE2 for SARS-CoV entry and development of a potent entry inhibitor

doi: 10.1016/j.virol.2006.01.029

Figure Lengend Snippet: Structure of ACE2. (A) Sequence alignment of human ACE2 and two homologous domains of human ACE. Charged amino acids are indicated in red or blue (negative and positive, respectively). K31 and Y41 are highlighted in yellow. (B) A crystal structure of ACE2 without the collectrin domain at the C-terminal end. Locations of amino acids shown to be important for binding S glycoprotein are indicated . α-Helices 1 and 2 are highlighted in yellow. Amino acid D615 at the C-terminus is shown as a reference. (C) Close-up view of α-helices 1 and 2. Charged amino acids are shown in red and blue. Polar and hydrophobic residues are shown in green and white, respectively. White dashed line represents an imaginary line connecting residues known to be important for binding S protein.

Article Snippet: Cells were washed twice with PBS and resuspended in 50 μl of Stain Buffer (BD Pharmingen) containing 0.1 μg/ml of Mouse IgG 2A anti-human ACE2 ectodomain monoclonal antibody (R&D Systems, # MAB9331).

Techniques: Sequencing, Binding Assay

Journal: Virology

Article Title: Identification of critical determinants on ACE2 for SARS-CoV entry and development of a potent entry inhibitor

doi: 10.1016/j.virol.2006.01.029

Figure Lengend Snippet: Characterization of mutant ACE2 proteins. (A) Infectivity analyses of the wild type and mutant ACE2 (60-min adsorption). (B) Kinetic analyses of SARS pseudovirus entry using the wild type or D30A mutant ACE2. Pseudoviruses were adsorbed to cells for various times as indicated. (C) Infectivity analyses of the wild type and mutant ACE2 (20-min adsorption). (D) Western blot analyses of ACE2 protein expression. (E) Comparison of cell surface expression of the wild type and D30A mutant ACE2 by flow cytometry. Cells transfected with pcDNA were used as a negative control.

Article Snippet: Cells were washed twice with PBS and resuspended in 50 μl of Stain Buffer (BD Pharmingen) containing 0.1 μg/ml of Mouse IgG 2A anti-human ACE2 ectodomain monoclonal antibody (R&D Systems, # MAB9331).

Techniques: Mutagenesis, Infection, Adsorption, Western Blot, Expressing, Comparison, Flow Cytometry, Transfection, Negative Control

Journal: Virology

Article Title: Identification of critical determinants on ACE2 for SARS-CoV entry and development of a potent entry inhibitor

doi: 10.1016/j.virol.2006.01.029

Figure Lengend Snippet: Characterization of mutant ACE2 proteins. (A) Analyses of SARS pseudovirus infectivity as a function of ACE2 amount. HeLa cells were transfected with indicated amounts of plasmids encoding either wild type or D30A mutant ACE2. The total amount of DNA transfected remained constant (1 μg) using pcDNA as filler DNA. (B) Western blot analyses of ACE2 expression in cells transfected with indicated amounts of plasmids expressing either wild type or D30A mutant proteins. (C) Infectivity analyses of the wild type and mutant ACE2 (0.25 μg plasmid, 60-min adsorption). (D) Infectivity analyses of the wild type and mutant ACE2 (0.25 μg plasmid, 40-min adsorption).

Article Snippet: Cells were washed twice with PBS and resuspended in 50 μl of Stain Buffer (BD Pharmingen) containing 0.1 μg/ml of Mouse IgG 2A anti-human ACE2 ectodomain monoclonal antibody (R&D Systems, # MAB9331).

Techniques: Mutagenesis, Infection, Transfection, Western Blot, Expressing, Plasmid Preparation, Adsorption

Journal: Virology

Article Title: Identification of critical determinants on ACE2 for SARS-CoV entry and development of a potent entry inhibitor

doi: 10.1016/j.virol.2006.01.029

Figure Lengend Snippet: Inhibitory effects of ACE2-derived peptides on SARS pseudovirus infection. (A) A crystal structure of an ACE2 peptide fragment (residues 22–57) as it appears in an intact protein. Five peptides derived from this fragment are shown (P1–P5). Amino acid residues are color-coded as in . (B) A crystal structure of ACE2 peptide fragments (residues 22–44 and 351–357). The primary sequence of peptide P6 is shown. Backbone tracing of a potential conformation of the two fragments connected by glycine is shown in the inset. (C) Inhibition of SARS pseudovirus infection as a function of concentration of six different peptides derived from ACE2. HeLa cells transfected with a plasmid expressing the wild type ACE2 were used. (D) VSV-G pseudovirus infection was not inhibited even at 100 μM.

Article Snippet: Cells were washed twice with PBS and resuspended in 50 μl of Stain Buffer (BD Pharmingen) containing 0.1 μg/ml of Mouse IgG 2A anti-human ACE2 ectodomain monoclonal antibody (R&D Systems, # MAB9331).

Techniques: Derivative Assay, Infection, Sequencing, Inhibition, Concentration Assay, Transfection, Plasmid Preparation, Expressing

Journal: Virology

Article Title: Identification of critical determinants on ACE2 for SARS-CoV entry and development of a potent entry inhibitor

doi: 10.1016/j.virol.2006.01.029

Figure Lengend Snippet: Structural analyses of interactions between ACE2 and RBD. (A) A bird's eye view of a crystal structure of the RBD of S protein (lime) bound to ACE2 (gray) . The RBM portion of the RBD is colored pink. The surface of amino acids that actually make contacts with ACE2 is shown in purple. The first two α-helices of ACE2 are shown in yellow as a reference. ACE2 residues that make contacts with RBM are shown in green. Charged residues shown to be important for pseudovirus infection in this study are shown in either red or blue. (B) A top view of the co-crystal structure. Residues shown to be important for infection but have not shown to make contacts with the RBD are indicated. (C) A side view of the co-crystal structure. The position of D454 residue of S protein is shown in orange. (D) A potential binding site of the P6 peptide on the RBD. Peptide fragments 22–44 and 351–357 are shown in yellow and cyan, respectively. The RBM is shown in pink, while the rest of the RBD is shown in lime.

Article Snippet: Cells were washed twice with PBS and resuspended in 50 μl of Stain Buffer (BD Pharmingen) containing 0.1 μg/ml of Mouse IgG 2A anti-human ACE2 ectodomain monoclonal antibody (R&D Systems, # MAB9331).

Techniques: Infection, Residue, Binding Assay

Journal: Cell reports

Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

doi: 10.1016/j.celrep.2022.111220

Figure Lengend Snippet: Figure 1. SARS-CoV-2 Delta exhibits increased infectivity over Kappa in Calu3 cells and is dependent on the NTD (A) Schematic diagrams of WT (with D614G), Kappa, and Delta with their chimeras bearing swapped NTDs. The consensus mutations be- tween Kappa and Delta are annotated in blue. The monomeric spikes shown on the right-hand side are for illustration purposes. PBCS, polybasic cleavage site; RBM, receptor-binding motif; FP, fusion peptide. (B) Western blots of purified PVs bearing either H69V70 deletion or WT, Kappa, or Delta spikes. The sizes of protein markers are labeled to the left of the blot, and the corresponding bands are labeled to the right. (C and D) The intensity of the spike-associated bands on the western blots was densitometrically quantified (ImageJ) before the ratio was calculated for cleavage (C; S2/FL, paired t test) or spike sta- bility (D; S2/S1; one sample t test). In both (C) and (D), each dot represents one PV preparation. (E) PV bearing Delta, Kappa, or chimeric spike was used to transduce Calu3 and organoids express- ing endogenous levels of ACE2 and TMPRSS2 and ACE2/TMPRSS2-overexpressing cell lines including HeLa-ACE2, Vero-ACE2/TMPRSS2, and A549-ACE2/TMPRSS2. Unpaired t test. (F) PV bearing WT, WT with Kappa NTD, and WT with Delta NTD were used to transduce Calu3 cells. In (E) and (F), mean ± SEM are shown for technical replicates (n = 2–4; two-sided unpaired Student t test). Data are representative of two to four experi- ments. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

Techniques: Infection, Binding Assay, Western Blot, Labeling, Transduction

Journal: Cell reports

Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

doi: 10.1016/j.celrep.2022.111220

Figure Lengend Snippet: Figure 3. Reverting mutations in the Delta NTD toward WT reduces infectivity in lung cells and increases neutralization sensitivity to vaccine- elicited antibody (A) PV bearing Delta and its reversions were used to transduce Calu3 and HeLa-ACE2 cells. Mean ± SEM are shown for technical replicates (n = 4; two-sided unpaired Student’s t test). (B) Examples of neutralization curves from ID32, -63, and -105 vaccinees with PVs bearing the reversion at 142, 156, or 157/8. Data points represent the mean of two technical replicates. (C) The 50% serum neutralization was plotted across ten sera showing the geometric mean with geometric SD. Paired Wilcoxon was used for analysis. Data are representative of two experiments. ns, not significant, *p < 0.05, **p < 0.01.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

Techniques: Infection, Neutralization, Transduction

Journal: Cell reports

Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

doi: 10.1016/j.celrep.2022.111220

Figure Lengend Snippet: Figure 4. The SARS-CoV-2 Delta NTD in- creases fusion kinetics of Kappa and WT spikes (A) A schematic diagram showing the split GFP system for spike-ACE2-mediated cell fusion. (B) 681R or 681H is required for the enhanced fu- sogenicity in Delta and its chimera bearing the Kappa NTD. (C) The fused Delta NTD in Kappa and WT increased the fusion kinetics of their counterparts, respectively. The line graphs on the right show the percentage of the positive GFP area at 12, 14, 16, 20, 22, and 23 h post transfection. The data showing the SEM at each time point were aver- aged from two experiments. The heatmap at each time point shows the mean of the GFP-positive area over the field of view from two experiments.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

Techniques: Transfection

Journal: Cell reports

Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

doi: 10.1016/j.celrep.2022.111220

Figure Lengend Snippet: Figure 5. The SARS-CoV-2 Delta NTD or BA.2 NTD does not alter spike fusion or sensitivity to TMPRSS2 of BA.1 (A) PV bearing Delta, BA.1, BA.2, or chimeric forms of BA.1 and BA.2 spike were used to transduce Calu3, H1299, and 293T expressing endogenous levels of ACE2 and TMPRSS2 and TMPRSS2-overexpressing 293T cells. (B) Fusion kinetics of the chimeric Delta NTD in BA.1 and BA.2 along with their parental spikes. The heatmap at each time point shows the mean of the GFP- positive area over the field of view from two experiments. The western blot showing cleavage of spike is directly underneath the heatmap. (C) PV bearing BA.1, BA.2, or chimeras with Delta were transduced into either parental 293T cells or 293T cells overexpressing TMPRSS2. The fold increase of the virus entry in TMPRSS2-overexpressing cells over parental cells is shown above the scatterplots. (legend continued on next page)

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

Techniques: Transduction, Expressing, Western Blot, Virus

Journal: Cell reports

Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

doi: 10.1016/j.celrep.2022.111220

Figure Lengend Snippet: Figure 1. SARS-CoV-2 Delta exhibits increased infectivity over Kappa in Calu3 cells and is dependent on the NTD (A) Schematic diagrams of WT (with D614G), Kappa, and Delta with their chimeras bearing swapped NTDs. The consensus mutations be- tween Kappa and Delta are annotated in blue. The monomeric spikes shown on the right-hand side are for illustration purposes. PBCS, polybasic cleavage site; RBM, receptor-binding motif; FP, fusion peptide. (B) Western blots of purified PVs bearing either H69V70 deletion or WT, Kappa, or Delta spikes. The sizes of protein markers are labeled to the left of the blot, and the corresponding bands are labeled to the right. (C and D) The intensity of the spike-associated bands on the western blots was densitometrically quantified (ImageJ) before the ratio was calculated for cleavage (C; S2/FL, paired t test) or spike sta- bility (D; S2/S1; one sample t test). In both (C) and (D), each dot represents one PV preparation. (E) PV bearing Delta, Kappa, or chimeric spike was used to transduce Calu3 and organoids express- ing endogenous levels of ACE2 and TMPRSS2 and ACE2/TMPRSS2-overexpressing cell lines including HeLa-ACE2, Vero-ACE2/TMPRSS2, and A549-ACE2/TMPRSS2. Unpaired t test. (F) PV bearing WT, WT with Kappa NTD, and WT with Delta NTD were used to transduce Calu3 cells. In (E) and (F), mean ± SEM are shown for technical replicates (n = 2–4; two-sided unpaired Student t test). Data are representative of two to four experi- ments. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

Techniques: Infection, Binding Assay, Western Blot, Labeling, Transduction

Journal: Cell reports

Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

doi: 10.1016/j.celrep.2022.111220

Figure Lengend Snippet: Figure 3. Reverting mutations in the Delta NTD toward WT reduces infectivity in lung cells and increases neutralization sensitivity to vaccine- elicited antibody (A) PV bearing Delta and its reversions were used to transduce Calu3 and HeLa-ACE2 cells. Mean ± SEM are shown for technical replicates (n = 4; two-sided unpaired Student’s t test). (B) Examples of neutralization curves from ID32, -63, and -105 vaccinees with PVs bearing the reversion at 142, 156, or 157/8. Data points represent the mean of two technical replicates. (C) The 50% serum neutralization was plotted across ten sera showing the geometric mean with geometric SD. Paired Wilcoxon was used for analysis. Data are representative of two experiments. ns, not significant, *p < 0.05, **p < 0.01.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

Techniques: Infection, Neutralization, Transduction

Journal: Cell reports

Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

doi: 10.1016/j.celrep.2022.111220

Figure Lengend Snippet: Figure 4. The SARS-CoV-2 Delta NTD in- creases fusion kinetics of Kappa and WT spikes (A) A schematic diagram showing the split GFP system for spike-ACE2-mediated cell fusion. (B) 681R or 681H is required for the enhanced fu- sogenicity in Delta and its chimera bearing the Kappa NTD. (C) The fused Delta NTD in Kappa and WT increased the fusion kinetics of their counterparts, respectively. The line graphs on the right show the percentage of the positive GFP area at 12, 14, 16, 20, 22, and 23 h post transfection. The data showing the SEM at each time point were aver- aged from two experiments. The heatmap at each time point shows the mean of the GFP-positive area over the field of view from two experiments.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

Techniques: Transfection

Journal: Cell reports

Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

doi: 10.1016/j.celrep.2022.111220

Figure Lengend Snippet: Figure 5. The SARS-CoV-2 Delta NTD or BA.2 NTD does not alter spike fusion or sensitivity to TMPRSS2 of BA.1 (A) PV bearing Delta, BA.1, BA.2, or chimeric forms of BA.1 and BA.2 spike were used to transduce Calu3, H1299, and 293T expressing endogenous levels of ACE2 and TMPRSS2 and TMPRSS2-overexpressing 293T cells. (B) Fusion kinetics of the chimeric Delta NTD in BA.1 and BA.2 along with their parental spikes. The heatmap at each time point shows the mean of the GFP- positive area over the field of view from two experiments. The western blot showing cleavage of spike is directly underneath the heatmap. (C) PV bearing BA.1, BA.2, or chimeras with Delta were transduced into either parental 293T cells or 293T cells overexpressing TMPRSS2. The fold increase of the virus entry in TMPRSS2-overexpressing cells over parental cells is shown above the scatterplots. (legend continued on next page)

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

Techniques: Transduction, Expressing, Western Blot, Virus

Journal: bioRxiv

Article Title: Bromodomain and Extraterminal Inhibition Blocks Inflammation-Induced Cardiac Dysfunction and SARS-CoV-2 Infection (Pre-Clinical)

doi: 10.1101/2020.08.23.258574

Figure Lengend Snippet: A) Schematic of the experiment. B) Lungs of SARS-CoV-2 infected K18-hACE2 mice 5 d.p.i. In comparison to the control there is sloughing of bronchial epithelium, and white arrowheads show (A) collapse of alveolar spaces and (B) bronchiolar lumen. C) Qualification of mapped reads in RNA-seq reveal severe lung infection with no/negligible heart infection. n = 5 mice per group. D) Volcano plot of lung RNA-seq reveals a robust upregulation (logFC > 0.5) of 419 genes and downregulation (logFC < −0.5) of 98 genes, both FDR < 0.05. n = 5 mice per group. E) Activation of viral responses in lungs revealed using KEGG pathway analysis of upregulated genes. Size represents number of genes regulated and the pathways of the coloured circles are highlighted by the text. F) Analysis of the transcriptional response predicts Stat1 and Ep300 as key mediators of infection in the lungs. G) Hearts of SARS-CoV-2 infected K18-hACE2 mice 5 d.p.i. The hearts appeared relatively normal without significant necrosis, fibrosis (Masson’s Tri-chrome not shown) or immune infiltrates. H) Volcano plot of heart RNA-seq reveals a robust upregulation (logFC > 0.5) of 249 and downregulation (logFC < −0.5) of 159 genes, both FDR < 0.05. n = 5 mice per group. I) Activation of viral responses in hearts revealed using KEGG pathway analysis of upregulated genes. Repression of ECM in hearts revealed using KEGG pathway analysis of downregulated genes. Size represents number of genes regulated and the pathways of the coloured circles are highlighted by the text. J) Analysis of the transcriptional response predicts Stat1 and Ep300 as key mediators of the response in the heart. K) PCA plot of heart RNA-seq samples. n = 4-5. L) Volcano plot of heart RNA-seq reveals a robust upregulation (logFC > 0.5) of 11 genes and downregulation (logFC < −0.5) of 91 genes, both FDR < 0.05 in SARS-CoV-2 infected K18-hACE2 mice treated with INCB054329. n = 4-5 mice per group. M) Repression of viral responses in hearts revealed using KEGG pathway analysis of down-regulated genes. Size represents number of genes regulated and the pathways of the coloured circles are highlighted by the text. N) Analysis of the transcriptional response predicts Ep300 as the key mediator of INCB054329 effects in the heart. O) Cross-analysis of the transcriptional responses in hCO with hearts of SARS-CoV-2 infected K18-hACE2 mice. P) Co-regulated genes in panel (O) reveals a consistent activation of viral responses in both models using KEGG pathway analysis of upregulated genes. Size represents number of genes regulated and the pathways of the coloured circles are highlighted by the text. Q) Heat-map of genes induced by both CS in hCO and SARS-CoV-2 infected K18-hACE2 mouse hearts that are also repressed with INCB054329 treatment. R) Severe weight loss by 4-5 d.p.i in SARS-CoV-2 infected K-18-hACE2 mice is due to severe lung infection and also brain infection and euthanasia is required. d.p.i. – days post infection. Data presented as mean ± standard error of the mean. ** p < 0.01, using Mann-Whitney *** p < 0.001 and **** p < 0.0001 using two-way ANOVA with Sidak’s post hoc test compared to CTRL. For D, H, L – red dots are regulated as per the described cut-offs and grey dots are not. For F,J and N - Values presented are adjusted P values, number of genes regulated by the transcription factor/number of genes regulated, and % of genes regulated over the total. The size of the coloured slices represent the fraction of genes regulated (180° = 100%), and overlaps for each transcription factor are also depicted.

Article Snippet: For ACE2 assays the following was used for control, 1:200 Goat IgG Alexa Fluor 647-conjugated antibody, and assay 1:200 anti-human ACE2 AlexFluor 647 conjugated antibody and 1:200 anti-human CD90 (all RnD Systems) and were incubated for 60 min at 4°C in Binding Buffer.

Techniques: Infection, Comparison, Control, RNA Sequencing, Activation Assay, MANN-WHITNEY

Journal: bioRxiv

Article Title: Bromodomain and Extraterminal Inhibition Blocks Inflammation-Induced Cardiac Dysfunction and SARS-CoV-2 Infection (Pre-Clinical)

doi: 10.1101/2020.08.23.258574

Figure Lengend Snippet: A) All BETi (except ABBV-744) previously used in clinical trials prevent CS-induced diastolic dysfunction. n = 12-19 hCOs per condition from 3 experiments. hPSC cardiac cells- HES3 (no endothelial cells). B) BETi specific for the BD2 domain (RVX-2157) or selective for the BD2 domain (apabetalone) prevent CS-induced diastolic dysfunction. n = 12-18 hCOs per condition from 3 experiments. hPSC cardiac cells- HES3 (no endothelial cells). C) Apabetalone decreases serum LGALS3BP in the phase IIb ASSURE clinical trial. Data are presented as a change from baseline. n = 47 placebo and 47 apabetalone. D) BETi specific for the BD2 domain (RVX-2157) or selective for the BD2 domain (apabetalone) decrease ACE2 expression after 3 days. hPSC cardiac cells – HES3. E) Pre-treatment with BETi specific for the BD2 domain (RVX-2157) or selective for the BD2 domain (apabetalone) for 3 days block SARS-CoV-2 infection. E-gene expression in 2D cultured hPSC-CM 3 days after infection. n = 6-8 from 2 experiments (pooled from hPSC cardiac cells- HES3 and AA). F) Dose-response curve for apabetalone 3 day pre-treatment to block SARS-CoV-2 infection. E-gene expression in 2D cultured hPSC-CM 3 days after infection. n = 6 from 1 experiment. hPSC cardiac cells- HES3. G) Apabetalone or JQ-1 3 day pre-treatment reduces SARS-CoV-2 titre in hPSC-CM 3 days after infection. n = 6 from 1 experiment. hPSC cardiac cells- HES3. TCID50 - Fifty-percent tissue culture infective dose. Data presented as mean ± standard error of the mean for all plots except for C which is median ± interquartile range. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p<0.0001, using one-way ANOVA with Dunnett’s multiple comparisons test (A,B – CS, E,F,G - DMSO) or Mann-Whitney (C).

Article Snippet: For ACE2 assays the following was used for control, 1:200 Goat IgG Alexa Fluor 647-conjugated antibody, and assay 1:200 anti-human ACE2 AlexFluor 647 conjugated antibody and 1:200 anti-human CD90 (all RnD Systems) and were incubated for 60 min at 4°C in Binding Buffer.

Techniques: Clinical Proteomics, Expressing, Blocking Assay, Infection, Gene Expression, Cell Culture, MANN-WHITNEY